Genome Reassembly with High-throughput Sequencing Data
Readers may take a look at an interesting genome assembly paper that came out in BMC Genomics. (h/t: @lexnederbragt @genetics_blog)
From the methods section,
As an example of how a reference sequence can aid in assembly, consider the de Bruijn graph of a donor genome “ATAGAGGCAATGAGCGTGGAGTTC” in Figure 1a. Note that this graph has two possible Eulerian tours, one in which the lower branch is taken first, and one in which the upper branch is taken first. Only one of these tours spells the original donor genome, and a de novo assembly can not distiguish between them. If, however, we are given the reference sequence “ATAGCAATCGTGTTC,” then it may be possible to discerne the correct tour. Figure 1c depicts the original de Bruijn graph augmented with the reference sequence, represented by red edges. In this new graph, it is now possible to choose the tour that is most parsimonious with the reference sequence. Stripping away the red edges that have no parallel blue edge, as shown in Figure 1d makes this more clear. We can now see that the tour following the upper branch first touches the reference edges 0, 3, 4, 8, and 11 in sequential order, with novel content in between. This indicates that the donor genome spelled by this tour represents a donor with only three insertions relative to the reference. The tour following the lower branch first touches the reference edges out of order in the sequence 0-8-3-4-11, indicating three insertions as well as a translocation. By appealing to parsimony, we can therefore conclude that the tour taking the upper branch first is the more likely of the two.
With this idea in mind, our method begins by building a graph of the contigs in the donor sequence. The construction of these contigs is flexible, and they may be derived from the sequencing reads through either de novo assembly or a hybrid process using both resequencing and assembly.
At Twitter, @lexnederbragt wondered whether the assembler is similar to Cortex assembler (covered here, here and here). Based on cursory reading, it did not seem to us that two approaches are similar. From a more knowledgeable source(@dzerbino), we came to know about two other papers, where similar assembly techniques were discussed.
Reference-assisted chromosome assembly - Jaebum Kim et al.
We have not had enough time to compare the approaches of above papers. However, the most valid criticism of the original manuscript came from C. Titus Brown, who pointed out that its assembly algorithm was demonstrated only on simulated data.
