Exo-Klenow Fragment for A-tailing and T-tailing
The Klenow fragment is a large protein fragment produced when DNA polymerase I from E. coli is enzymatically cleaved by the protease subtilisin. First reported in 1970,[1] it retains the 5’-3’ polymerase activity and the 3 ? 5 exonuclease activity for removal of precoding nucleotides and proofreading, but loses its 5’ ? 3’ exonuclease activity.
The other smaller fragment formed when DNA polymerase I from E. coli is cleaved by subtilisin retains the 5’-3’ exonuclease activity but does not have the other two activities exhibited by the Klenow fragment (i.e. 5’-> 3’ polymerase activity, and 3’->5’ exonuclease activity).
exo-Klenow fragment
Just as the 5’ ? 3’ exonuclease activity of DNA polymerase I from E.coli can be undesirable, the 3’ ? 5’ exonuclease activity of Klenow fragment can also be undesirable for certain applications. This problem can be overcome by introducing mutations in the gene that encodes Klenow. This results in forms of the enzyme being expressed that retain 5’ ? 3’ polymerase activity, but lack any exonuclease activity (5’ ? 3’ or 3’ ? 5’). This form of the enzyme is called the exo- Klenow fragment.
The exo-Klenow fragment is used in some fluorescent labeling reactions for microarray.
Use -
Detection of ultra-rare mutations by next-generation sequencing (PNAS 2012) to help A-tailing and T-tailing. Quoting from their supplementary text -
Adapter Synthesis. Duplex Tag-labeled adapters were synthesized from two oligonucleotides (PAGE purified; Integrated DNA Technologies), designated as the primer strand: AATGATACGGCGACCACCGAGATCTACACTCTTTCCCTACACGACGCTCTTCCGATCT and the template strand: /5phos/ACTGNNNNNNNNNNNNAGATCGGAAGAGCACACGTCTGAACTCCAGTCAC. The two adapter strands were annealed by combining equimolar amounts of each oligo to a final concentration of 50 ?M and heating to 95 C for 5 min. The oligo mix was allowed to cool to room temperature over 1 h. The annealed primer-template complex was extended in a reaction consisting of 40 ?M primer template, 25 units Klenow exo? DNA polymerase (New England Biolabs), 250 ?M each dNTP, 50 mM NaCl, 10 mM Tris-HCl pH 7.9, 10 mM MgCl2, and 1 mM DTT for 1 h at 37 C. The product was purified by ethanol precipitation. Due to the partial A-tailing property of Klenow exo-, this protocol results in a mixture of blunt-ended adapters and adapters with a single-nucleotide A overhang. A single-nucleotide A overhang was added to residual blunt fragments by incubating the adapters with 25 units Klenow exo-, 1 mM dATP, 50 mM NaCl, 10 mM Tris-HCl pH 7.9, 10 mM MgCl2, and 1 mM DTT for 1 h at 37 C. The product was again ethanol precipitated and resuspended to a final concentration of 50 ?M.
T-tailing was performed in a reaction containing 5 units Klenow exo-, 1 mM dTTP, 50 mM NaCl, 10 mM Tris-HCl pH 7.9, 10 mM MgCl2, and 1 mM DTT. The reaction proceeded for 1 h at 37 C. DNA was purified with 1.2 volumes of AMPure XP beads. The custom Duplex Sequencing adapters were ligated by combining 750 ng of Ttailed DNA with 250 pmol adapters in a reaction containing 3,000 units T4 DNA ligase (Enzymatics), 50 mM Tris-HCl pH 7.6, 10 mM MgCl2, 5 mM DTT, and 1 mM ATP. The reaction was incubated at 25 C for 15 min, and purified with 0.8 volumes of Ampure XP beads.
